> Molecular Diagnostics
> Exosome RNA Isolation Kits
> Urine Sample Preparation
> Saliva Sample Preparation
> Sputum Sample Preparation
> Blood/Plasma/Serum Sample Preparation
> DNA Purification Kits
> RNA Purification Kits
> Protein Purification Kits
> Sample Collection and Preservation Kits
> DNA, RNA and Protein Ladders
> Buffers, Reagents and Assays
> PCR Reagents
> Plastics and Filtration Devices
 

Norgen Biotek Corp. is dedicated to providing our customers with first class sample preparation kits for RNA, microRNA, DNA and protein purification, clean-up and concentration and to providing dedicated and expert support services to our customers and partners worldwide.

As a testament of our commitment to quality, Norgen is proud to be an ISO 9001:2008 and ISO 13485:2003 registered company.

It is a pleasure to serve you and we look forward to working closely with you to provide the best sample preparation products for your specific needs.

Please contact us at:
info@norgenbiotek.com

Norgen Biotek Corp.
3430 Schmon Parkway, Thorold
Ontario, Canada, L2V 4Y6

Tel: (905) 227-8848
Fax: (905) 227-1061
 
Back to RNA/DNA/Protein Purification Kit (Cat# 23500 )

Effects of Adenovirus Super-Infection on Transcription and Translation from a Gene under the MLP Tripartite Leader Sequence

M. El-Mogy1 and Y. Haj-Ahmad1,21Brock University, St. Catharines, ON, CANADA. 2Norgen Biotek Corp., Thorold, ON, CANADA
 
Abstract
 
Adenoviruses are commonly used as a tool for the study and understanding of gene expression, oncogenic transformation, DNA replication, gene delivery and other molecular biological phenomenon. Upon infection of permissive cells and during the late phase of the viral life cycle the adenovirus major late promoter (MLP) is the predominant promoter, and together with the tripartite leader sequence (TPL) is responsible for the abundant late viral protein production. In this study, we investigated the effect of the incomplete and complete TPL sequence on mRNA transcription and translation under the control of the adenoviral wild type super-infection. A series of plasmids containing the MLP, with partial and complete TPL exons (exon 1, exon 1 & 2 and exon 1, 2 & 3) were used and gene expression was evaluated in Chinese hamster ovary (CHO) cells using the green fluorescence protein (GFP) as a reporter gene. After plasmid transfection and adenoviral wild type super-infection, GFP mRNA transcription levels were measured over time via RT-qPCR. Translation levels were determined by direct ELISA using anti-GFP antibodies. Following transfection, no significant changes in mRNA transcription efficiency were obtained with the incorporation of the different TPL exons. On the other hand, wild type super-infection showed a minimum effect on transcription efficiency induction from cassettes without TPL or with only the first TPL exon. Induction of transcription efficiency was observed when using TPL exons 1+2 or the complete TPL (exons 1+2+3). Similarly, protein translational levels showed the same trend, with maximum levels when the complete TPL form was used. These results emphasize the effect of wild type adenovirus trans-activation on MLP and TPL activity and the importance of the complete TPL structure on mRNA stability and function.
 
Introduction
 
• The late phase of adenovirus infection is characterized by the production of an abundant amount of late proteins required to form and assemble the new viral capsids. Active translation in this phase is attributed to the activity of the major late promoter (MLP) and the presence of the tripartite leader sequence (TPL).
 
• TPL is a 5’ untranslated sequence present in all of the late, but none of the early, viral mRNA. The adenovirus serotype 5 (Ad5) leader sequence is 201 bp, formed by the splicing of three exons during post-translational modifications. TPL facilitates mRNA transport and accumulation in the cytoplasm and is responsible for the selective translation of the late viral proteins in preference to the cellular proteins (9).
 
• Adenovirus E1B-55K and E4-orf6 play the main role in active transport of TPL-containing mRNA from the nucleus to the cytoplasm (1, 8). The viral transcription sites in the nucleus contain a complex of E1B-55K and E4-orf6 (6). Evidence suggests that viral mRNA interacts with this complex through the ability of E1B-55K to bind RNA (7) and facilitate its transport to the cytoplasm using the E4-orf6 proteins nuclear localization and transport signals (2). Cellular mRNA transport is blocked by the same complex (5).
 
• Translation of any TPL-attached mRNA is eIF-4F-independent (4). The relaxed secondary structure of TPL facilitates its function in translation initiation even when eIF-4F is inhibited (3).
 
• In order to understand the effect of the TPL on transcription from MLP and mRNA transport and translation, in the presence or absence of the other viral proteins, four plasmids were constructed. This allows us to determine whether the viral proteins expressed from the wild type adenovirus dl309 are important for plasmid stability and functionality of the complete or partial sequence of TPL. The four plasmids contain MLP as a common promoter and TPL with all, partial or no exons. We investigated mRNA transcription, transport, stability and expression levels of green florescence protein (GFP) gene from each construct, after transfection and wild-type super-infection into Chinese hamster ovary (CHO) cells.
 
Methods
 
• Four plasmids (pMGA, pMT1GA, pMT1,2GA and pMT1,2,3GA) were constructed with partial or complete Ad5 TPL exons and GFP as a reporter gene under the control of Ad5 MLP (Figure 1). Plasmids were prepared by CsCl gradients.
 
• Equal amounts of each plasmid were transfected into CHO cells using the calcium phosphate method. Transfection of each plasmid was done in triplicate wells in 6-well plates, and each plate was done in duplicate. The medium was replaced 6 h post-transfection.
 
• 12 h post-transfection, one set of the transfections was super-infected with the wild type dl309.
 
• Total RNA, DNA and proteins were isolated from the transfected and transfected/super-infected cells using Norgen’s RNA/DNA/Protein Purification Kit (Norgen Biotek. Corp., Thorold, ON, Canada). Samples were collected after 0, 0.5, 1.5 and 3.5 days post-transfection.
 
• All isolated RNAs were treated with Ambion`s turbo DNase (Ambion, Austin, TX, USA) to digest any residual DNA background and were then cleaned using Norgen`s RNA Clean-Up and Concentration Kit (Norgen Biotek. Corp., Thorold, ON, Canada). Specific PCR for GFP fragment was used to check the success of the digestion step.
 
• qPCR and qRT-PCR were performed on the isolated DNA and RNA samples, using 1x SYBR GREEN master mix (Bio-Rad, Hercules, CA, USA), and specific primers for GFP fragment (Forward: 5’ ATCCTGATCGAGCTGAATGG 3’ and Reverse: 5’ TGCCATCCTCGAT-GTTGTG 3’). Reactions were performed using a Bio-Rad iCycler thermal cycler.
 
Results
 
 
Figure 1: Schematic diagram of the constructs used. Each of the four constructed plasmids (pMGA, pMT1GA, pMT1,2GA and pMT1,2,3GA) contain a common promoter (MLP), reporter gene (GFP) and poly A signal (SV40 poly A). Tripartite leader sequence exons were cloned downstream of MLP and upstream from the reporter gene. Exon 1, exons 1,2 and the full TPL sequence were cloned to construct pMT1GA, pMT1,2GA and pMT1,2,3GA, respectively. 
 
 
Figure 2: Copy numbers of the different plasmids over 3.5 days post-transfection into CHO cells, with transfection and super-infection conditions. Copy numbers were obtained by qPCR using a standard curve of known plasmid DNA concentration. qPCR was performed on equal amounts of DNA isolated from collected samples. Plasmids names are shown on the figure with transfection (▬) and super-infection ()conditions.
 
 
Figure 3: GFP mRNA transcripts from the different plasmids over 3.5 days post-transfection into CHO cells, with transfection and super-infection conditions. Copy numbers were obtained by qPCR using a standard curve of known plasmid DNA concentration. qPCR was performed on equal volumes of RT product from equal amount of RNA isolated from collected samples. Plasmids names are shown on the figure with transfection (▬) and super-infection () conditions.
 
 
Figure 4: Transcription efficiency of GFP mRNA over 3.5 days post-transfection into CHO cells, with transfection and super-infection conditions. Efficiency was defined as GFP mRNA copy numbers per plasmid per cell. Copy numbers per cell of plasmid DNA and GFP mRNA were estimated by qPCR using a standard curve of a known plasmid concentration. Plasmids names are shown on the figure with transfection (▬) and super-infection () conditions.
 
Conclusions
 
 Wild type adenovirus super-infection does not affect plasmid stability in all the tested constructs.
 
Super-infection enhances mRNA levels from constructs that have partial or complete TPL sequence. The presence of TPL exons 1+2 or the complete TPL structure is important for this enhancement since the increased mRNA levels were significant (at P<0.05).
 
Transcription efficiency was increased with the super-infection when using TPL exons 1+2 or the complete TPL. However, the increase was significant only with the complete TPL structure.
 
 In general, the complete TPL increased mRNA transport and accumulation when compared to the incomplete forms. In addition, super-infection was more efficient with the complete TPL over the other forms.  It seems that the entire TPL structure is important in the interaction with viral proteins.
 
References
 
1.            Bridge, E. and Ketner, G. 1990. Virology 174: 345-353.
 
2.            Dobbelstein, M., Roth, J., Kimberly, W.T., Levine, A. J. and Shenk, T. 1997. EMBO J. 16: 4276-4284.
 
3.            Dolph, P. J., Huang, J. and Schneider, R. J. 1990. J. Virol. 64: 2669-2677.
 
4.            Dolph, P. J., Racaniello, V., Villamarin, A., Palladino, F. and Schneider, R. J. 1988. J. Virol. 62: 2059-2066.
 
5.            Flint, S. J. and Gonzalez, R. A. 2003. Curr. Top. Microbiol. Immunol. 272: 287-330.
 
6.            Gonzalez, R. A. and Flint, S. J. 2002. J. Virol. 76: 4507-4519.
 
7.            Horridge, J. J. and Leppard, K. N. 1998. J. Virol. 72: 9374-9379.
 
8.            Leppard, K. N. and Shenk, T. 1989. EMBO J. 8: 2329-2336.
 
9.            Zhang, Y., Feigenblum, D. and Schneider, R. J. 1994. Journal of Virology 68: 7040-7050.
 
Acknowledgements
 
The authors would like to thank the Egyptian Government and the Egyptian Cultural & Educational Bureau in Canada for their financial support of this project. The authors would also like to thank the staff of Norgen Biotek for their technical assistance and Pam Roberts for her help in preparing this poster.
 
 
 
 


-----------------------------------------------------------------------------------------------------------------------------------------------------------------------

Home | About Us | Products | Services | Product Info | Contact Us
Providing innovative tools for genomic and proteomic research

3430 Schmon Parkway, Thorold, ON L2V 4Y6 Canada
Phone: (905) 227-8848 | Toll Free: 1-866-NORGENB (667-4362) | Fax: (905) 227-1061 | email: info@norgenbiotek.com