> Molecular Diagnostics
> Exosome RNA Isolation Kits
> Urine Sample Preparation
> Saliva Sample Preparation
> Sputum Sample Preparation
> Blood/Plasma/Serum Sample Preparation
> DNA Purification Kits
> RNA Purification Kits
> Protein Purification Kits
> Sample Collection and Preservation Kits
> DNA, RNA and Protein Ladders
> Buffers, Reagents and Assays
> PCR Reagents
> Plastics and Filtration Devices
 

Norgen Biotek Corp. is dedicated to providing our customers with first class sample preparation kits for RNA, microRNA, DNA and protein purification, clean-up and concentration and to providing dedicated and expert support services to our customers and partners worldwide.

As a testament of our commitment to quality, Norgen is proud to be an ISO 9001:2008 and ISO 13485:2003 registered company.

It is a pleasure to serve you and we look forward to working closely with you to provide the best sample preparation products for your specific needs.

Please contact us at:
info@norgenbiotek.com

Norgen Biotek Corp.
3430 Schmon Parkway, Thorold
Ontario, Canada, L2V 4Y6

Tel: (905) 227-8848
Fax: (905) 227-1061
 
Back to RNA/DNA/Protein Purification Kit (Cat# 23500 )

Rapid and Sensitive PCR-Based Method for Site-Specific DNA Mutation Detection

M. El-Mogy1 and Y. Haj-Ahmad1,21Brock University, St. Catharines, ON, CANADA. 2Norgen Biotek Corp., Thorold, ON, CANADA
 
Abstract
 
Mutation detection is important for examining DNA quality, as well as the suitability of the DNA for different applications including mutagenesis studies. The conventional methods for mutation detection are based on monitoring the biological activity of the expressed proteins, which is not applicable to regulatory sequences, or by DNA sequencing. Both of these methods are time consuming and impractical, and not amenable to high throughput screening of mutation rates and frequencies. In this study we report on the development and evaluation of a rapid and simple PCR-based procedure for the detection of mutations. The method worked very efficiently in both eukaryotic and prokaryotic cells. Using this method we were able to detect the proportional increment in mutation rate with increasing EtBr concentrations. Furthermore, we were able to precisely detect the number of mutated DNA molecules in a given volume of DNA. Overall, this PCR-based method is rapid, highly sensitive and quantitative.
 
Introduction
 
•  The late phase of adenovirus infection is characterized by the production of an abundant amount of late proteins required to form and assemble the new viral capsids. Active translation in this phase is attributed to the activity of the major late promoter (MLP) and the presence of the tripartite leader sequence (TPL).
 
• Plasmid DNA is widely used to deliver genes into mammalian cells for the construction of new cell lines, gene therapy and gene expression studies. DNA quality, as well as sequence accuracy, are crucial for all the functions and processes performed inside the cell.  Mutations in the regulatory sequences such as promoters or enhancers can stop or down-regulate the expression efficiency. Also, mutations in the coding sequences can lead to the expression of partially active or completely inactive proteins. Therefore, DNA mutation detection has gained more attention.
 
• The gold standard in DNA mutation detection is the dideoxy sequencing method and is usually coupled with PCR amplification for higher sensitivity (1,2). Despite its accuracy, this method is both time consuming and labour intensive when used for high-throughput screening, since the sequencing is performed on one molecule at a time.
 
• Other protein-based methods use the activity of a reporter gene as a mutation detection sensor (3). However, these methods do not determine the specific mutation site and can introduce false negative results with low mutation levels.
 
• In the present study, we developed a mutation detection method based on the coupling of restriction enzyme digestion and PCR amplification, using mammalian expression plasmid DNA and ethidium bromide (EtBr) as a mutagen.
 
Methods
 
• The plasmid pCMVb was prepared using Norgen’s Plasmid DNA MaxiPrep Kit (Endotoxin-Free) (Norgen Biotek Corp., Thorold, ON, Canada). This kit was used because it does not include ethidium bromide in any of the steps.
 
• The plasmid pCMVb was spiked with different concentrations of ethidium bromide (0, 2.5, 25 and 250 nM), in a triplicate manner. The DNA was incubated for 10 minutes at room temperature, with subsequent transfection into Chinese hamster ovary (CHO) cells using the calcium phosphate method in a 24-well plate. Following transfection the plates were incubated at 37ºC and 5% CO2.
 
• 21 hours post-transfection, DNA was isolated using Norgen’s RNA/DNA/Protein Purification Kit (Norgen Biotek Corp., Thorold, ON, Canada).
 
• The isolated DNA was then digested overnight with HindIII, followed by heat inactivation of the enzyme.
 
• PCR and qPCR reactions were performed on undigested and digested plasmid using specific primers (F: 5' TCGCTACCATTACCAGTT-              GGTC 3' & R: 5' GAGTTAGCTCACTCATTAGGCACC 3') flanking the digestion site to detect the mutations and determine the mutation rate inside the HindIII recognition site (AAGCTT). The presence of any mutation within the site will prevent the digestion and subsequently increase the amplification (Figure 1).
 
Results
 
Figure 1: Strategy of mutation detection in HindIII recognition site (AAGCTT) of pCMVβ. HindIII digestion is followed with PCR amplification using primers flanking the digestion sites. Any mutation in the AAGCTT sequence will prevent HindIII digestion and amplification takes place.
 
Figure 2: PCR amplification before and after HindIII digestion of DNA isolated from cells transfected with pCMVβ spiked with EtBr.  (A) undigested DNA, (B) digested DNA and (C) the controls. The amplicon size of 677 bp and EtBr spiking concentrations, as well as the control conditions are shown on the figure. L corresponds to Norgen’s PCRSizer DNA Ladder. Amplification was obtained from all the undigested DNA samples and only from the high EtBr-spiking concentrations of digested DNA. The controls were the same plasmid batch prepared for the experiment, +ve digestion and –ve digestion correspond to PCRs performed on plasmid DNA with and without HindIII digestion, respectively. The –ve and +ve are no template control and positive control, respectively.
 
 
Figure 3: Percentage of pCMVβ molecules with lost HindIII sites. Values were determined through qPCR of EtBr-spiked DNA (concentrations: 0, 2.5, 25 & 250 nM), before and after HindIII digestion. The percentage of molecules that lost the HindIII site is positively correlated to the EtBr-spiking concentration.
 
Conclusions
 
• The developed method of mutation detection within a specific sequence, based on restriction enzyme digestion/PCR amplification, is   sensitive in detecting mutations within high copy numbers of DNA molecules.
 
• The method uses qPCR for precise estimation of the mutation rate by quantifying the plasmid copy number in undigested and digested conditions. A mutation rate of 9.8% was obtained, which is considered high, since the screening was based on only 0.084% of the plasmid length. This indicates the accuracy of the method and shows high sensitivity with the simple procedure.
 
• The method can be used for high throughput screening of mutation rates within a specific sequence without the need for DNA sequencing. Also, the new method is highly accurate when compared to the protein activity-based methods.
 
References
 
1. Galicka, A. and GindzieƄski, A. (2002). Direct sequencing of PCR products for mutation detection in osteogenesis imperfecta. J. Appl.            Genet. 43: 365-369.
 
2. Ogino, S.; Kawasaki, T.; Brahmandam, M.; Yan, L.; Cantor, M.; Namgyal, C.; Mino-Kenudson, M.; Lauwers, G. Y.; Loda, M. and Fuchs, C. S. (2005). Sensitive sequencing method for KRAS mutation detection by Pyrosequencing. J. Mol. Diagn. 7: 413-421.
 
3. Tak, Y. K.; Naoghare, P. K.; Lee, K. H.; Park, S. S. and Song, J. M. (2008). Green fluorescent protein (GFP) as a direct biosensor for mutation detection: elimination of false-negative errors in target gene expression. Anal. Biochem. 380: 91-98.
 
 Acknowledgements
 
The authors would like to thank the Egyptian Government and the Egyptian Cultural & Educational Bureau in Canada for their financial support of this project. The authors would also like to thank the staff of Norgen Biotek for their technical assistance and Pam Roberts for her help in preparing this poster.
 
 


-----------------------------------------------------------------------------------------------------------------------------------------------------------------------

Home | About Us | Products | Services | Product Info | Contact Us
Providing innovative tools for genomic and proteomic research

3430 Schmon Parkway, Thorold, ON L2V 4Y6 Canada
Phone: (905) 227-8848 | Toll Free: 1-866-NORGENB (667-4362) | Fax: (905) 227-1061 | email: info@norgenbiotek.com